View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3330_low_13 (Length: 228)
Name: NF3330_low_13
Description: NF3330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3330_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 3087080 - 3086866
Alignment:
| Q |
1 |
atgatataatgaagtcatgtgaaacactgttgtcaattagttgttgagtaaaaggaaacaaaatttgagttctttgcttatggtacactgttacctatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3087080 |
atgatataatgaagtcatgtgaaacactgttgtcaattagttgttgagtaaaaggaaacaaaatttgagttctttgcttatggtacactgttacctatac |
3086981 |
T |
|
| Q |
101 |
atgcaaatgcaacttggaagcaacatatttgtggtctcaaggtcacgatttccacgactaggtgatgcaattgtagttga-aaaatggctggtattagga |
199 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3086980 |
atgcaaatgcaacttgcaagcaacatgtttgtggtctccaggtcacgatttccacgactaggtgatgcaattgtagttgaaaaaatggctggtattagga |
3086881 |
T |
|
| Q |
200 |
gcattagtttttgct |
214 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3086880 |
gcattagtttttgct |
3086866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University