View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3330_low_3 (Length: 457)
Name: NF3330_low_3
Description: NF3330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3330_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 56; Significance: 5e-23; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 394 - 449
Target Start/End: Complemental strand, 7917234 - 7917179
Alignment:
| Q |
394 |
tttcgtagtttatacataatttgaatatcctcaatttttaaccttgcacctttgct |
449 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7917234 |
tttcgtagtttatacataatttgaatatcctcaatttttaaccttgcacctttgct |
7917179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 130 - 208
Target Start/End: Complemental strand, 7920047 - 7919972
Alignment:
| Q |
130 |
aatcatgcaaccatcaatacaaatcgttggattaaaaataacatgattatcttgttcaggctttgtattttgaatttga |
208 |
Q |
| |
|
|||||||||||| |||||| | ||||| ||||||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
7920047 |
aatcatgcaaccgtcaatatatatcgtatgattaaaaataac---attatcttgttatgactttgtattttgaatttga |
7919972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 21 - 65
Target Start/End: Original strand, 7935058 - 7935102
Alignment:
| Q |
21 |
tggcttgttggtctcaatattggaaacccttggagggaatgagag |
65 |
Q |
| |
|
||||||||||||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
7935058 |
tggcttgttggtctcaatattggaagcactttgagggaatgagag |
7935102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University