View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3330_low_9 (Length: 250)
Name: NF3330_low_9
Description: NF3330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3330_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 26 - 229
Target Start/End: Original strand, 33749648 - 33749857
Alignment:
| Q |
26 |
gagagtagcaagaacaagaagacaagaagatcccaccaacgaatgatcacctgaaggtaaatggtcaaatcagaagtgaaatatcaaaacacactcttta |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33749648 |
gagagtagcaagaacaagaagacaagaagatcccaccaacgaatgatcacctgaagggaaatggtcaaatcagaagtgaaatatcaaaacacactcttta |
33749747 |
T |
|
| Q |
126 |
------caccgagagtgagagtgaactctaaatctaatttcattttcgttccccacctcttatgtggcgctttctccttaaccctcatatttgcaccctc |
219 |
Q |
| |
|
||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33749748 |
cactgtcactgatagtgagagtgaactctaaatctaatttcattttcgttccccacctcttatgtggcgctttctccttaaccctcatatttgcaccctc |
33749847 |
T |
|
| Q |
220 |
aagtctatat |
229 |
Q |
| |
|
|| ||||||| |
|
|
| T |
33749848 |
aaatctatat |
33749857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University