View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3331_low_16 (Length: 238)
Name: NF3331_low_16
Description: NF3331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3331_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 46512080 - 46511852
Alignment:
| Q |
1 |
tgagtatttaggtgcctgcactgttatattctatgtagcaagtttgaaagattaaaatatataccgcattactgtactttttcaagttcagtgaaggtgt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46512080 |
tgagtgtttaggtgcctgcactgttatattctatgtagcaagtttgaaagattaaaatatataccgcattactgtactttttcaagttcagtgaaggtgt |
46511981 |
T |
 |
| Q |
101 |
aattatctttgagcatgtaatgaaaaaagtgatattgtatttggatctataagtcttaattttcaagtttaatgtgtttttgagattggcactgtaagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46511980 |
aattatctttgagcatgtaatgaaaaaagtgatattgtatttggatctataagtcttaattttcaagtttaatgtgtttttgagattggcactgtatgac |
46511881 |
T |
 |
| Q |
201 |
attgtatttgcaaactttcaatgatgatg |
229 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
46511880 |
attgtatttgcaaactttcaataatgatg |
46511852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 139 - 194
Target Start/End: Original strand, 15313750 - 15313805
Alignment:
| Q |
139 |
atttggatctataagtcttaattttcaagtttaatgtgtttttgagattggcactg |
194 |
Q |
| |
|
||||||||| |||||||||||||| |||||| ||||||||| |||||| |||||| |
|
|
| T |
15313750 |
atttggatcaataagtcttaatttggaagtttgatgtgttttggagattagcactg |
15313805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University