View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3332_low_8 (Length: 269)
Name: NF3332_low_8
Description: NF3332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3332_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 36571749 - 36571992
Alignment:
| Q |
17 |
ctatactactgtgatgaagtggatagatctcgtttgcagctttataagagagagatgggcaaaa-ggtgaaaaatatatatgtagaaat-----gaataa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
36571749 |
ctatactactgtgatgaagtggatagatctcgtttgcagctttataagagagagatgggcaaaaaggtgaaaaatatatatgtagaaattaaatgaataa |
36571848 |
T |
 |
| Q |
111 |
atgaaaactgggagtgtgcattgtggagcccaatttgtgttggttagggtgattggtaacatatactgatatgaatacat---tacattcaccacccttc |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36571849 |
atgaaaactgggagtgtgcaatgtggagcccaatttgtgttggttggggtgattggtaacatatactgatatgaatacattactacattcaccacccttc |
36571948 |
T |
 |
| Q |
208 |
cttctgctggataaactgtagtttgtgatctgaaacgacctttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36571949 |
cttctgctggataaactgtagtttgtgatcagaaacgacctttc |
36571992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University