View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3333_high_4 (Length: 233)
Name: NF3333_high_4
Description: NF3333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3333_high_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 328905 - 329126
Alignment:
| Q |
13 |
gcaatcgcatcagctcataattgcccctccaagagtttttgcaatgtgaatgattgggagtgtgtcattattatttgaagagagatgctattcattacga |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
328905 |
gcaatcgcatcagctcacaattgcccctccaagagtttttgcaatgtgaatgattgggagtgtgtcattattatttgaaatgagatgctattcattacga |
329004 |
T |
|
| Q |
113 |
atgcccgta-cacgaaacgccagaaccatttattttaaaataagtcaacaatattttaagttgtctttgatggaatacatgaggtatcggaagtggaacc |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
329005 |
atgcccgtaacacgaaacgccagaaccatttattttaaaataagtcaacaatattttaagttgtctttgatggaatacatgaggtatcggaagtggaacc |
329104 |
T |
|
| Q |
212 |
actaaatagaagcactttcact |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
329105 |
actaaatagaagcactttcact |
329126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University