View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3334_high_12 (Length: 249)
Name: NF3334_high_12
Description: NF3334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3334_high_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 46864479 - 46864240
Alignment:
| Q |
11 |
cacagacaaaccaaggctgtaaagacacattaccattttcatgggttccaaacatggggcagcttgtccgttaggtgtgatgcaattaaa-tcaccataa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46864479 |
cacagacaaaccaaggctgtaaagacacattaccattttcatgggttccaaacatggggcagcttgtccgttaggtgtgatgcaattaaaatcaccataa |
46864380 |
T |
 |
| Q |
110 |
aatggtgtgtctgagttatgtttgtgagtcacaaaccaaaccagactaccattgccattttttgcaagtatgcttagtattggcaaatcaatgtgcacca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46864379 |
aatggtgtgtctgagttatgtttgtgagtcacaagccaaaccagactaccattgccattttttgcaagtatgcttagtattggcaaatcaatgtgcacca |
46864280 |
T |
 |
| Q |
210 |
agttttaaaactatatattatttgggtgtaaatcaggtat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46864279 |
agttttaaaactatatattatttgggtgtaaatcaggtat |
46864240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University