View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3334_high_15 (Length: 226)

Name: NF3334_high_15
Description: NF3334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3334_high_15
NF3334_high_15
[»] chr3 (1 HSPs)
chr3 (5-226)||(35078108-35078323)


Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 35078323 - 35078108
Alignment:
5 caaatcaggccaccggaaaattacgcaatgtttgtgtccccataaattgggtaaaattggagggaattgatacaacaaactaacgacattgcttagttat 104  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
35078323 caaatcaggccaccggaaaattatgcaatgtttgtgtccccataaattgggtaaaattggagggaattgatacaacaaacaaacgacattgcttagttat 35078224  T
105 ttcttcgatttgttttggacgataaagtcttgctctgctgatatctaatattctaaatatnnnnnnnnnggtttaatttgtcactgggagagagaactaa 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||          |||||||||||||||||    |||||||||    
35078223 ttcttcgatttgttttggacgataaagtcttgctctgctgatatctaatattct--atataaaaaaaaaagtttaatttgtcactgg----gagaactaa 35078130  T
205 atcacagcatcgtcattgttaa 226  Q
    ||||||||||||||||||||||    
35078129 atcacagcatcgtcattgttaa 35078108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University