View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3334_high_15 (Length: 226)
Name: NF3334_high_15
Description: NF3334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3334_high_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 5 - 226
Target Start/End: Complemental strand, 35078323 - 35078108
Alignment:
| Q |
5 |
caaatcaggccaccggaaaattacgcaatgtttgtgtccccataaattgggtaaaattggagggaattgatacaacaaactaacgacattgcttagttat |
104 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35078323 |
caaatcaggccaccggaaaattatgcaatgtttgtgtccccataaattgggtaaaattggagggaattgatacaacaaacaaacgacattgcttagttat |
35078224 |
T |
 |
| Q |
105 |
ttcttcgatttgttttggacgataaagtcttgctctgctgatatctaatattctaaatatnnnnnnnnnggtttaatttgtcactgggagagagaactaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
35078223 |
ttcttcgatttgttttggacgataaagtcttgctctgctgatatctaatattct--atataaaaaaaaaagtttaatttgtcactgg----gagaactaa |
35078130 |
T |
 |
| Q |
205 |
atcacagcatcgtcattgttaa |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35078129 |
atcacagcatcgtcattgttaa |
35078108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University