View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3335_high_18 (Length: 267)
Name: NF3335_high_18
Description: NF3335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3335_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 14 - 252
Target Start/End: Complemental strand, 45273347 - 45273109
Alignment:
| Q |
14 |
gaaggacgtggtgggttgtagaagtgcttgtgctgctttcaactctcctaggtattgctgtactggtaactttgctaccccacagacctgcaagcccact |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45273347 |
gaagcacgtggtgggttgtagaagtgcttgtgctgctttcaactctcctaggtattgctgtactggtaactttggtaccccacagacctgcaagcccact |
45273248 |
T |
 |
| Q |
114 |
gcttattcaagaatcttcaaaactgcttgcccaaaggcttactcttatgcttatgatgaccctaccagtattgctacttgcaccaatgctagttacatga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45273247 |
gcttattcaagaatcttcaaaactgcttgcccaaaggcttactcttatgcttatgatgaccctaccagtattgctacttgcaccaatgctagttacatga |
45273148 |
T |
 |
| Q |
214 |
tcactttctgccctcgtaaccgccgttgatcatctatct |
252 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
45273147 |
tcactttctgccctcgtcaccgtcgttgatcatctatct |
45273109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 92 - 193
Target Start/End: Complemental strand, 30024834 - 30024733
Alignment:
| Q |
92 |
cccacagacctgcaagcccactgcttattcaagaatcttcaaaactgcttgcccaaaggcttactcttatgcttatgatgaccctaccagtattgctact |
191 |
Q |
| |
|
||||||| | || ||||||||| |||||| |||||||| || |||||||| ||||||||||||||||| | |||||| ||||| ||||||| |||| |
|
|
| T |
30024834 |
cccacaggcttgtaagcccactagttattcgagaatctttaagttggcttgccctaaggcttactcttatgcctttgatgatcctacaagtattgttact |
30024735 |
T |
 |
| Q |
192 |
tg |
193 |
Q |
| |
|
|| |
|
|
| T |
30024734 |
tg |
30024733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University