View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3335_high_26 (Length: 236)
Name: NF3335_high_26
Description: NF3335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3335_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 45874202 - 45874000
Alignment:
| Q |
1 |
tcctcctccttttgtaattttcatgttactttcaatcacttgttatattatcttgatctggattgagaagctaaaagttaactaatgagaggaacaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45874202 |
tcctcctccttttgtaattttcatgttactttcaatcacttgttatattatcttgatctggattgagaagctaaaagttaactaatgagaggaacaaaaa |
45874103 |
T |
 |
| Q |
101 |
ttgaannnnnnnggtgttcaattcttatgacgctgtaaaattgatttatagaaatttaatgttacgaaatttgagttcactttctatgttgtttatcaca |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45874102 |
ttgaatttttttggtgttcaattcttatgacgctgtaaaattgatttatagaaatttaatgttacgaaatttgagttcactttctatgttgtttatcaca |
45874003 |
T |
 |
| Q |
201 |
aga |
203 |
Q |
| |
|
||| |
|
|
| T |
45874002 |
aga |
45874000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University