View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3335_high_30 (Length: 212)
Name: NF3335_high_30
Description: NF3335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3335_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 38322331 - 38322532
Alignment:
| Q |
1 |
aaatgttctgtcatttaccttattagttttctcttgatttttcattgtatcccatacacccagagaagtcgagttgtttctctcgacacaagaattttca |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322331 |
aaatgttctgtcatttaccttcttagttttctcttgatttttcattgtatcccatacacccagagaagtcgagttgtttctctcgacacaagaattttca |
38322430 |
T |
 |
| Q |
101 |
tagttttacctttttattttatnnnnnnnttctgttacagccatgtagttccttgtcagacgcgttctgcattgcaaaaaagggcatgatctctgctcct |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38322431 |
tagttttacctttttattttataaaaaaactctgttacagccatgtagttccttgtcagacgcgttctgcattgcaaaaaagggcatgatctctgctgct |
38322530 |
T |
 |
| Q |
201 |
cc |
202 |
Q |
| |
|
|| |
|
|
| T |
38322531 |
cc |
38322532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University