View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3335_high_9 (Length: 365)
Name: NF3335_high_9
Description: NF3335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3335_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 102 - 347
Target Start/End: Complemental strand, 41258349 - 41258090
Alignment:
| Q |
102 |
tggcataaattgaattaattgaaccgcaatttctcattatttgcttggagaatcaaaatcaatgtgaaatgtataccagtagtaattgcgaa-------- |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41258349 |
tggcataaattgaattaattgaaccgcaatttctcattattcgcttggagaatgaaaatcaatgtgaaatgtatactagtagtaattgcgaaataaaggt |
41258250 |
T |
 |
| Q |
194 |
-----caataattaatgagggcatagaatcatagtagcattaaataagatgaattgtttaagcaacaaaaa-tgagtaaaaacaagatgttttcattcat |
287 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41258249 |
cataacaataattaatgagggcatagaatgatagtagcattaaataagatgaattgtttaagcaacaaaaaatgagtaaaaacaagatgttttcattcat |
41258150 |
T |
 |
| Q |
288 |
gaatcagactcctactacatcagaaacacactgagatccaaaatgcattgctacaaacac |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41258149 |
gaatcagactcctactacatcagaaacacactgagatccaaaatgcattgctacaaacac |
41258090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University