View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3335_low_16 (Length: 295)
Name: NF3335_low_16
Description: NF3335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3335_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 16 - 112
Target Start/End: Original strand, 51963595 - 51963691
Alignment:
| Q |
16 |
attcaatcatgtgatttgagcatcttatatgtggttcacaatagacactattaatgaagtgagtgaaatacagtgtgttagtaagttggatcaatat |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51963595 |
attcaatcatgcgatttgagcatcttatatgtggttcacaatagacactattaatgaagtgagtgaaatacagtgtgttagtaagttggatcaatat |
51963691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 179 - 279
Target Start/End: Original strand, 51963758 - 51963858
Alignment:
| Q |
179 |
caatattattttaaacctttctttgaaacgaataaagcaatgagaataactatagcagcaaagaaattatgctgaattttggtttaatagtaaatgttca |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
51963758 |
caatattattttaaacctttctttgaaacgaataaagcaatgagaataattatagcagcaaaaaagttatgctgaattttggtttaatagtaaatgttca |
51963857 |
T |
|
| Q |
279 |
t |
279 |
Q |
| |
|
| |
|
|
| T |
51963858 |
t |
51963858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University