View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3335_low_29 (Length: 229)
Name: NF3335_low_29
Description: NF3335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3335_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 14 - 197
Target Start/End: Complemental strand, 40809469 - 40809286
Alignment:
| Q |
14 |
cagagatatctatgaagtgatcatgtggggggactttccactaacttgaagataaactaaaaagtaaaatatataaaaagagaacaatgttagctagctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809469 |
cagagatatctatgaagtgatcatgtggggggactttccactaacttgaagataaactaaaaagtaaaatatataaaaagagaacaatgttagctagctt |
40809370 |
T |
 |
| Q |
114 |
ctttgtttttatataccataccaattctgtgggctaatgactgactcaatatatttggattctcatgtagtactttatatggag |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809369 |
ctttgtttttatctaccataccaattctgtgggctagtgactgactcaatatatttggattctcatgtagtactttatatggag |
40809286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University