View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3335_low_31 (Length: 218)
Name: NF3335_low_31
Description: NF3335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3335_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 31876384 - 31876518
Alignment:
| Q |
18 |
gaggacactgacaaagatgacgacgatgatgatgaagaataggagacaaaagttgatgacgccgcgggagaccgatcaagaacatgatccttttttgtag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31876384 |
gaggacactgacaaagatgacgacgatgatgatgaagaataggagacaaaagttgatgacgccgcgggggaccgatcaagaacacaatccttttttgtag |
31876483 |
T |
 |
| Q |
118 |
tacgtttgtggaatagtgtttgcaaaaagaagttc |
152 |
Q |
| |
|
|||| ||||||||||||| ||| ||||| |||||| |
|
|
| T |
31876484 |
tacgcttgtggaatagtgattgtaaaaaaaagttc |
31876518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University