View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3336_low_9 (Length: 264)
Name: NF3336_low_9
Description: NF3336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3336_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 68 - 206
Target Start/End: Complemental strand, 30347998 - 30347860
Alignment:
| Q |
68 |
gaaggagtcctaacccaacatatgaacactactcatggtcacattgatgctctctcgaaaaatcatgaggaatctcaaagaaatactgagacatcaatta |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30347998 |
gaaggagtcctaacccaacatatgaacactactcatggtcacattgatgctctctcgaaaaatcatgaggaatctcaaagaaatactgaaacatcaatta |
30347899 |
T |
 |
| Q |
168 |
agaacttagagacacaaattagatagatttctacacaac |
206 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30347898 |
agaacttagagacacaaattaggtagatttctacacaac |
30347860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 206
Target Start/End: Original strand, 29828126 - 29828268
Alignment:
| Q |
64 |
ttttgaaggagtcctaacccaacatatgaacactactcatggtcacattgatgctctctcgaaaaatcatgaggaatctcaaagaaatactgagacatca |
163 |
Q |
| |
|
|||||||| |||| |||||||| | ||||| |||||| | |||||||| | | ||| ||| |||||||| |||||||||||||| || | | ||| |
|
|
| T |
29828126 |
ttttgaagaagtcttaacccaatacatgaagactacttagagtcacatttaatcaatcttgaagaatcatgatgaatctcaaagaaacaccaaagcttca |
29828225 |
T |
 |
| Q |
164 |
attaagaacttagagacacaaattagatagatttctacacaac |
206 |
Q |
| |
|
|| |||||||||||||| |||||| | | ||||||||||||| |
|
|
| T |
29828226 |
ataaagaacttagagactcaaattgggaatatttctacacaac |
29828268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University