View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3338_high_2 (Length: 235)
Name: NF3338_high_2
Description: NF3338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3338_high_2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 9497281 - 9497064
Alignment:
| Q |
18 |
tcgttttcaggtgacaatattaagaaagacaaagcctctgcatgtacaataaaaattctaatagaagtaacttcaaacaaggataaagatattaacgaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9497281 |
tcgttttcaggtgacaatattaagaaagacaaagcctctgcatgttcaataaaaattctaataggagtaacttcaaacaaggataaagatattaacgaat |
9497182 |
T |
|
| Q |
118 |
gtccaaagctgggatcgttcaggaataagttacaatggaaccgagggttttcaactggcttgcaaaagactatgcgagaggcatgcaactgtaagtgcaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9497181 |
gtccaaagctgggatcgttcaggaataagttacaagggaacagagggttttcaactggcttgcaaaagactatgcgagaggcatgcaactgtaagtgcaa |
9497082 |
T |
|
| Q |
218 |
gtgtgtgttagtaacatc |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9497081 |
gtgtgtgttagtaacatc |
9497064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University