View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3338_high_3 (Length: 218)

Name: NF3338_high_3
Description: NF3338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3338_high_3
NF3338_high_3
[»] chr4 (1 HSPs)
chr4 (18-214)||(43227535-43227728)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 43227535 - 43227728
Alignment:
18 agagtggcagttatacatataacttagataaactataaataaacaatttgctgaattacttttggtactgtacgtacctaaaccnnnnnnnnggttgatg 117  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||        ||||||      
43227535 agagtggcagttatacatataacttagataaactataaatcaacaatttgctgaattacttttggtactgtacgtacctaaaccttttttttggttga-- 43227632  T
118 aggaaacaagtgcggcagatggaacaggttgatacagaagcagcaactcaaagatggattgcaccgaatgtgggagaactgaaatgaaatgtggatg 214  Q
     |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43227633 -ggaaacaagtgcagcagatggaacaggttgatacagaagcagcaactcaaagatggattgcaccgaatgtgggagaactgaaatgaaatgtggatg 43227728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University