View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3338_low_2 (Length: 235)

Name: NF3338_low_2
Description: NF3338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3338_low_2
NF3338_low_2
[»] chr4 (1 HSPs)
chr4 (18-235)||(9497064-9497281)


Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 9497281 - 9497064
Alignment:
18 tcgttttcaggtgacaatattaagaaagacaaagcctctgcatgtacaataaaaattctaatagaagtaacttcaaacaaggataaagatattaacgaat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
9497281 tcgttttcaggtgacaatattaagaaagacaaagcctctgcatgttcaataaaaattctaataggagtaacttcaaacaaggataaagatattaacgaat 9497182  T
118 gtccaaagctgggatcgttcaggaataagttacaatggaaccgagggttttcaactggcttgcaaaagactatgcgagaggcatgcaactgtaagtgcaa 217  Q
    ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9497181 gtccaaagctgggatcgttcaggaataagttacaagggaacagagggttttcaactggcttgcaaaagactatgcgagaggcatgcaactgtaagtgcaa 9497082  T
218 gtgtgtgttagtaacatc 235  Q
    ||||||||||||||||||    
9497081 gtgtgtgttagtaacatc 9497064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University