View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3338_low_3 (Length: 218)
Name: NF3338_low_3
Description: NF3338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3338_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 43227535 - 43227728
Alignment:
| Q |
18 |
agagtggcagttatacatataacttagataaactataaataaacaatttgctgaattacttttggtactgtacgtacctaaaccnnnnnnnnggttgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43227535 |
agagtggcagttatacatataacttagataaactataaatcaacaatttgctgaattacttttggtactgtacgtacctaaaccttttttttggttga-- |
43227632 |
T |
|
| Q |
118 |
aggaaacaagtgcggcagatggaacaggttgatacagaagcagcaactcaaagatggattgcaccgaatgtgggagaactgaaatgaaatgtggatg |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43227633 |
-ggaaacaagtgcagcagatggaacaggttgatacagaagcagcaactcaaagatggattgcaccgaatgtgggagaactgaaatgaaatgtggatg |
43227728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University