View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3340_low_8 (Length: 278)
Name: NF3340_low_8
Description: NF3340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3340_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 114 - 263
Target Start/End: Original strand, 44439815 - 44439961
Alignment:
| Q |
114 |
ttagggtttgattttagaaatggaaagcttacacgtgtagtgagagaacgagcagcgattccctttaaaagaatggtcgccatggaagcccttcggatgt |
213 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
44439815 |
ttagggtttgattttaggaatggaaagcttacacgtgtagtgagagaacgagcagcgattcccttgaaaagaatggttgccatggaagcacttctgatgt |
44439914 |
T |
 |
| Q |
214 |
gaggaatgagttttcacaacgcagacaacttcgaactaaggtgtttatat |
263 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44439915 |
gaggaatg---tttcacaacgcagacaacttcgaactaaggtgtttatat |
44439961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 44439709 - 44439768
Alignment:
| Q |
11 |
caaaggatacccattaccgaaaaatggaaaaagcatggaactttatgattataaacaggt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44439709 |
caaaggatacccattaccgaaaaatggaaaaagcatggaactttatgattataaacaggt |
44439768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University