View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3340_low_9 (Length: 212)
Name: NF3340_low_9
Description: NF3340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3340_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 115 - 190
Target Start/End: Original strand, 2065171 - 2065246
Alignment:
| Q |
115 |
tgttgtgcatgaaaatgttttaagtgtaattttgttttggtttgagaaaataggataggagagggagagggcacgt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065171 |
tgttgtgcatgaaaatgttttaagtgtaattttgttttggtttgagaaaataggataggagagggagagggcacgt |
2065246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 49910463 - 49910513
Alignment:
| Q |
19 |
atgaaggtgttgttgttgttgttggcataggaaaaaagagtgtttttgtgt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49910463 |
atgaaggtgttgttgttgttgttggcataggaaaaaagagtgtttttgtgt |
49910513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University