View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_high_104 (Length: 227)
Name: NF3342_high_104
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_high_104 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 140 - 227
Target Start/End: Complemental strand, 15888398 - 15888311
Alignment:
| Q |
140 |
ttactctaatagggtacatgaagtattcaacaacctttattagttttcttgtataaattaagatgtgaatgctattgcttgtatatca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15888398 |
ttactctaatagggtacatgaagtattcaacaacctttattagttttcttgtataaattaagatgtgaatgctattgcttgtatatca |
15888311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 15888537 - 15888465
Alignment:
| Q |
1 |
taccttctattgctgctgtgcagctaatagaatgatgtaacatattagttctttatgttttgaattcgtttgt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15888537 |
taccttctattgctgctgtgcagctaatagaatgatgtaacatattagttctttatgttttgaattcgtttgt |
15888465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University