View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_high_47 (Length: 308)
Name: NF3342_high_47
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 17 - 297
Target Start/End: Original strand, 8255752 - 8256028
Alignment:
| Q |
17 |
agcagtgatgcactgtgatgttttccaatttcacgtatttctaccaatgtcatgcgctccaatcgggtcgaggcgcccccatgttgggtctgatacacta |
116 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
8255752 |
agcagtcatgcgctgtgatgttttccaatttcacgtatttctaccaatgtcatgcgctccaatcgggtcgaggctcccccgtgctgggtctgatacacta |
8255851 |
T |
 |
| Q |
117 |
caaatacgnnnnnnnnatcatatggtagctagtcatcttggaatcactcttcatatgagaaacttgtgctctagcggagaaattcattagaggttgaatt |
216 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8255852 |
caaatacgttttttttatcatatggtag----tcatcttggaatcactcttcatatgagaaacttgtgttctagcggagaaattcattagaggttgaatt |
8255947 |
T |
 |
| Q |
217 |
ggtacacaacagaggtgttctcttcaaaaattgttgatgcctacttgtgattcttatctttgttatatcaattatgttctt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8255948 |
ggtacacaacagaggtgttctcttcaaaaattgttgatgcctacttgtgattcttatctttgttatatcaattatgttctt |
8256028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University