View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_high_56 (Length: 280)
Name: NF3342_high_56
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_high_56 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 34898834 - 34899113
Alignment:
| Q |
1 |
cggggatagaaacaacaatagttaattaccatattttggtcattcgaggtgtctaaaatcctaatgtagatttgacgatacatgtctgatgggatatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34898834 |
cggggatagaaacaacaatagttaattaccatattttggtcattcgaggtgtctaaaatcctaatgtagatttgacgatacatgtctgatgggatatcta |
34898933 |
T |
|
| Q |
101 |
ccttttgctagggttttcgatcgattttgatcaacctagccttatgagccgaaaaggttaataaccggtcgtttgtgaaaaaactctcatccagtcttcc |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34898934 |
ccttttgctagggttcccgatcgattttgatcaacctagccttatgagccgaaaaggttaaaaaccggtcgtttgtgaaaaaactctcatccagtcttcc |
34899033 |
T |
|
| Q |
201 |
ttaattttttgtcggcatacttgatcaatttctctgtgttcaaatcacatagttgttgtcctcgtgagcttagctcagtt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34899034 |
ttaattttttgtcggcatacttgatcaatttctctgtgttcaaatcacatagttgttgtcctcgtgatcttagctcagtt |
34899113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 252 - 280
Target Start/End: Complemental strand, 33451422 - 33451394
Alignment:
| Q |
252 |
gttgttgtcctcgtgagcttagctcagtt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33451422 |
gttgttgtcctcgtgagcttagctcagtt |
33451394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University