View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_high_66 (Length: 254)
Name: NF3342_high_66
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_high_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 119 - 226
Target Start/End: Original strand, 18067184 - 18067291
Alignment:
| Q |
119 |
ttcttctttctatatattagaatttaaaattcaacatatattgattcaattgattagaaatttattcatacaacataatgacgtagttcacctcttttgc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18067184 |
ttcttctttctatatattagaatttaaaattcaacatatgttgattcaattgattaaaaatttattcatacaacataatgacgtagttcacctctcttgc |
18067283 |
T |
 |
| Q |
219 |
tttgtatt |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
18067284 |
tttgtatt |
18067291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 135 - 213
Target Start/End: Original strand, 18068442 - 18068520
Alignment:
| Q |
135 |
ttagaatttaaaattcaacatatattgattcaattgattagaaatttattcatacaacataatgacgtagttcacctct |
213 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
18068442 |
ttagaatttataagtcaacatatattgattcaattgattagaaatttattcatacaatataatgatgtagttcaactct |
18068520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University