View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_high_71 (Length: 251)
Name: NF3342_high_71
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_high_71 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 18012442 - 18012203
Alignment:
| Q |
1 |
tgttagtgtccaaaatcaacacgacattagggcatgtatgcgctttatagggtgtgattatatactttccatttctacttgttgaatgtcaannnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18012442 |
tgttagtgtccaaaatcaacacgacattagggcatgtatgcgctttataggttgtgat-atatactttccatttctacttgttgaatgtcaattttttct |
18012344 |
T |
 |
| Q |
101 |
nnnnnnnnacattgtagatgaaattccacgaacttctgatgcttttggggctgataatcatagtatggcagtagatttcaagccagatacaactttatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18012343 |
ttttctttacattgtagatgaaattccacgaacttctgatgcttctggggctgataatcatagtatggcagtagatttcaagccagatacaactttatca |
18012244 |
T |
 |
| Q |
201 |
aatgtaagtaaaaatattttggtttctttcgattctctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18012243 |
aatgtaagtaaaaatattttggtttctttcgattctttctg |
18012203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University