View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_high_78 (Length: 249)
Name: NF3342_high_78
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_high_78 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 236
Target Start/End: Complemental strand, 44636292 - 44636064
Alignment:
| Q |
8 |
catgtgtatgccatcatatgtatctatgtagttacataagtattattatttgatgttaactattttgcatgagatccatcacgttatagttatactttgc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44636292 |
catgtgtatgccatcatatgtatctatgtagttacataagtattattatttgatgttaactattttgcatgagatccatcacgttatagttatactttgc |
44636193 |
T |
|
| Q |
108 |
tatgcacatgaaatgatactccatcttattaccgtatatatggattggagcaaacaaataatcagattactgctgcaaatagacggggttttccccatat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44636192 |
tatgcacatgaaatgatactccatcttattaccgtatatatggattggagcaaacaaataatcagattactgctacaaatagacggggttttccccatat |
44636093 |
T |
|
| Q |
208 |
ttttatgcaaaacttgcaactttttgtct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44636092 |
ttttatgcaaaacttgcaactttttgtct |
44636064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University