View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3342_high_78 (Length: 249)

Name: NF3342_high_78
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3342_high_78
NF3342_high_78
[»] chr2 (1 HSPs)
chr2 (8-236)||(44636064-44636292)


Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 236
Target Start/End: Complemental strand, 44636292 - 44636064
Alignment:
8 catgtgtatgccatcatatgtatctatgtagttacataagtattattatttgatgttaactattttgcatgagatccatcacgttatagttatactttgc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44636292 catgtgtatgccatcatatgtatctatgtagttacataagtattattatttgatgttaactattttgcatgagatccatcacgttatagttatactttgc 44636193  T
108 tatgcacatgaaatgatactccatcttattaccgtatatatggattggagcaaacaaataatcagattactgctgcaaatagacggggttttccccatat 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
44636192 tatgcacatgaaatgatactccatcttattaccgtatatatggattggagcaaacaaataatcagattactgctacaaatagacggggttttccccatat 44636093  T
208 ttttatgcaaaacttgcaactttttgtct 236  Q
    |||||||||||||||||||||||||||||    
44636092 ttttatgcaaaacttgcaactttttgtct 44636064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University