View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_high_88 (Length: 241)
Name: NF3342_high_88
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_high_88 |
 |  |
|
| [»] scaffold1613 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 34158839 - 34159052
Alignment:
| Q |
18 |
gatagatggttatgaatatcgttttcaatggttgtttgtgatggagtctgattttggt-gtgaggttttattttggtggttattgtcctcataggtgttg |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34158839 |
gatagatggttatgaacatcgttttcaatggttgtttgtgacggagtctgattttggtagtgaggttttattttggtggttattgtcctcataggtgttg |
34158938 |
T |
 |
| Q |
117 |
aaggtatgtgtgtttgaggtgttgttcgtatggatgtcttttatgatgtttatttttgggtgttctgtctatatacaacgtttttaatttgtagttttta |
216 |
Q |
| |
|
||| |||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
34158939 |
aagacatgtgtgtttgaggtgttgtgcgtatgaatgtcttttatgatgtttatttttaggtgttttgtctatatacaacgtttttaatttgtagtttcta |
34159038 |
T |
 |
| Q |
217 |
attcgttggtctct |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34159039 |
attcgttggtctct |
34159052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 27 - 173
Target Start/End: Original strand, 27905642 - 27905784
Alignment:
| Q |
27 |
ttatgaatatcgttttcaatggttgtttgtgatggagtctgattttggtg-tgaggttttattttggtggttattgtcctcataggtgttgaaggtatgt |
125 |
Q |
| |
|
||||| |||||||||| | |||| ||||| | | ||||||||||||||| |||||||| |||||||||||||||||| | | |||||||||| || |
|
|
| T |
27905642 |
ttatggatatcgtttttagtggtggtttgcaacgaagtctgattttggtggtgaggttt-attttggtggttattgtctttaagggtgttgaagtta--- |
27905737 |
T |
 |
| Q |
126 |
gtgtttgaggtgttgttcgtatggatgtcttttatgatgtttattttt |
173 |
Q |
| |
|
| |||| ||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
27905738 |
gggttt-aggtgttgtctgtatgggtgtcttttatggtgtttattttt |
27905784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 181
Target Start/End: Complemental strand, 38544535 - 38544437
Alignment:
| Q |
83 |
tttattttggtggttattgtcctcataggtgttgaaggtatg-tgtgtttgaggtgttgttcgtatggatgtcttttatgatgtttatttttgggtgttc |
181 |
Q |
| |
|
|||||||||||| | |||||||||| ||||||||||||| | | || | ||||||||| ||| |||||||||||||| |||||||||| |||||||| |
|
|
| T |
38544535 |
tttattttggtgtatgttgtcctcatgggtgttgaaggtacgatttggct-aggtgttgtgtgtagggatgtcttttatggtgtttattttcgggtgttc |
38544437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 24 - 120
Target Start/End: Original strand, 34101407 - 34101503
Alignment:
| Q |
24 |
tggttatgaatatcgttttcaatggttgtttgtgatggagtctgattttggtgtgaggttttattttggtggttattgtcctcataggtgttgaagg |
120 |
Q |
| |
|
|||||||| |||||||||| || ||| ||||| | |||||||| |||||||| | | ||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
34101407 |
tggttatggatatcgtttttaacggtggtttgcaacggagtctggttttggtggtaaggtttatattggtggttattgtcctcatgggtgttgaagg |
34101503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 192
Target Start/End: Complemental strand, 17278213 - 17278172
Alignment:
| Q |
151 |
tgtcttttatgatgtttatttttgggtgttctgtctatatac |
192 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
17278213 |
tgtcttttatgatgtttattttcgggtgttccgcctatatac |
17278172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 196
Target Start/End: Complemental strand, 19814969 - 19814924
Alignment:
| Q |
151 |
tgtcttttatgatgtttatttttgggtgttctgtctatatacaacg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19814969 |
tgtcttttatgatgtttatttttgggtgttctgcttatatacaacg |
19814924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 83 - 209
Target Start/End: Original strand, 23983506 - 23983632
Alignment:
| Q |
83 |
tttattttggtggttattgtcctcataggtgttgaaggtatg-tgtgtttgaggtgttgttcgtatggatgtcttttatgatgtttatttttgggtgttc |
181 |
Q |
| |
|
||||||||||||| | |||||||||| |||||||||||| | | || | ||||||||| ||| |||||||||||||||||||||||||||| || || |
|
|
| T |
23983506 |
tttattttggtgggtgttgtcctcatgtgtgttgaaggtaaggtatgact-aggtgttgtgtgtagggatgtcttttatgatgtttatttttggatgctc |
23983604 |
T |
 |
| Q |
182 |
tgtctatatacaacgtttttaatttgta |
209 |
Q |
| |
|
| |||||||| | | ||||||||||| |
|
|
| T |
23983605 |
cgcctatatacgatgcctttaatttgta |
23983632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 16952095 - 16952049
Alignment:
| Q |
151 |
tgtcttttatgatgtttatttttgggtgttctgtctatatacaacgt |
197 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
16952095 |
tgtcttttatgatgtttatttttggatgttctgcctatatacgacgt |
16952049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 17022760 - 17022714
Alignment:
| Q |
151 |
tgtcttttatgatgtttatttttgggtgttctgtctatatacaacgt |
197 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
17022760 |
tgtcttttatgatgtttatttttggatgttctgcctatatacgacgt |
17022714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 118
Target Start/End: Original strand, 23650529 - 23650561
Alignment:
| Q |
86 |
attttggtggttattgtcctcataggtgttgaa |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
23650529 |
attttggtggttattgtcctcatgggtgttgaa |
23650561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 13018038 - 13017979
Alignment:
| Q |
151 |
tgtcttttatgatgtttatttttgggtgttctgtctatatacaacgtttttaatttgtagt |
211 |
Q |
| |
|
|||||||||||||||||||||| || |||| |||||||||||||| ||||||||||||| |
|
|
| T |
13018038 |
tgtcttttatgatgtttatttt-ggatgtttcgtctatatacaacgcctttaatttgtagt |
13017979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 209
Target Start/End: Complemental strand, 40689485 - 40689424
Alignment:
| Q |
148 |
ggatgtcttttatgatgtttatttttgggtgttctgtctatatacaacgtttttaatttgta |
209 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | |||||||||| ||||| |||||| |
|
|
| T |
40689485 |
ggatgtcttttatgatatttatttttgggtgtttcgcttatatacaacacttttagtttgta |
40689424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1613 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold1613
Description:
Target: scaffold1613; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 181
Target Start/End: Complemental strand, 814 - 716
Alignment:
| Q |
83 |
tttattttggtggttattgtcctcataggtgttgaaggtatg-tgtgtttgaggtgttgttcgtatggatgtcttttatgatgtttatttttgggtgttc |
181 |
Q |
| |
|
|||||||||||| | |||||||||| ||||||||||||| | | || | ||||||||| ||| |||||||||||||| |||||||||| |||||||| |
|
|
| T |
814 |
tttattttggtgtatgttgtcctcatgggtgttgaaggtacgatttggct-aggtgttgtgtgtagggatgtcttttatggtgtttattttcgggtgttc |
716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 192
Target Start/End: Original strand, 1760960 - 1761018
Alignment:
| Q |
133 |
aggtgttgttcgtatggatgtcttttatgatgtttatttttgggtgttctgtctatatac |
192 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| | |||||| ||| |||||||||| |
|
|
| T |
1760960 |
aggtgttgtgcgtatgaatgtcttttatgatgttta-tattgggttttccgtctatatac |
1761018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 192
Target Start/End: Complemental strand, 24072012 - 24071971
Alignment:
| Q |
151 |
tgtcttttatgatgtttatttttgggtgttctgtctatatac |
192 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
24072012 |
tgtcttttatgatgtttattttcgggtgttccgcctatatac |
24071971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University