View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_100 (Length: 236)
Name: NF3342_low_100
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_100 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 55076967 - 55077186
Alignment:
| Q |
1 |
caatagtcaatgttgataatttataggatgacgtcggctgcttcggggagttgttaagtgcttttagtggattaaagaaaccaatgtggatgctaatgat |
100 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076967 |
caattgtcaatgtttgtaatttataggatgacgtcggctgcttcggggagttgttaagtgcttttagtggattaaagaaaccaatgtggatgctaatgat |
55077066 |
T |
 |
| Q |
101 |
agtaaccgctataaattgggtagcatggttcccatttttcttgttcgacactgattggatgggtcgtgaagtgtatggtggcaatgttggagataatacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55077067 |
agtaaccgctataaattgggtagcatggttcccatttttcttgttcgatactgattggatgggtcgtgaagtgtatggtggcaatgttggagataatacc |
55077166 |
T |
 |
| Q |
201 |
tatgccgctggtgtgcgcgc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
55077167 |
tatgccgctggtgtgcgcgc |
55077186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 172
Target Start/End: Original strand, 42340914 - 42340970
Alignment:
| Q |
116 |
ttgggtagcatggttcccatttttcttgttcgacactgattggatgggtcgtgaagt |
172 |
Q |
| |
|
|||||| |||||||||| ||||| || ||| |||||||||||||||| |||||||| |
|
|
| T |
42340914 |
ttgggttgcatggttcctattttctttattcaacactgattggatgggccgtgaagt |
42340970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 84 - 184
Target Start/End: Complemental strand, 15124933 - 15124833
Alignment:
| Q |
84 |
atgtggatgctaatgatagtaaccgctataaattgggtagcatggttcccatttttcttgttcgacactgattggatgggtcgtgaagtgtatggtggca |
183 |
Q |
| |
|
||||||||||| ||| | || ||||| || |||||||| |||||||| || || |||||||||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
15124933 |
atgtggatgctgatgttggttaccgcgatcaattgggttgcatggtttccgttcttcttgttcgacactgattggatgggtcaagaagtatacggtggca |
15124834 |
T |
 |
| Q |
184 |
a |
184 |
Q |
| |
|
| |
|
|
| T |
15124833 |
a |
15124833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 175
Target Start/End: Original strand, 10932546 - 10932650
Alignment:
| Q |
71 |
attaaagaaaccaatgtggatgctaatgatagtaaccgctataaattgggtagcatggttcccatttttcttgttcgacactgattggatgggtcgtgaa |
170 |
Q |
| |
|
|||||||| |||||||||||| | ||| ||||||| || | || ||| | || |||||||| || ||||||||||||||||| |||||||| ||||| |
|
|
| T |
10932546 |
attaaagagaccaatgtggatattgatgttagtaacagccgtgaactggatcgcgtggttcccgttcttcttgttcgacactgactggatgggccgtgag |
10932645 |
T |
 |
| Q |
171 |
gtgta |
175 |
Q |
| |
|
||||| |
|
|
| T |
10932646 |
gtgta |
10932650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University