View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_104 (Length: 232)
Name: NF3342_low_104
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_104 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 11029827 - 11029622
Alignment:
| Q |
11 |
tgaaaagaagaaaaaacctgaggggcataacttataagttagaattacaaatactatggttttacaacgggatagcattgcaaaacgagggaggttttac |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11029827 |
tgaaatgaagaaaaaacctgaggggcataacttataagttagaattacaaatacaatggttttacaacgggatagcattgcaaaacgagggaggttttac |
11029728 |
T |
 |
| Q |
111 |
attcgggatcattcccttcgctatatttagcatttttgaatttataatgagtaatcaaccagcaaatataagtatcaaaccctagaaacattatttaaga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11029727 |
attcgggatcattcccttcgctatatttagcatttttgaatttataatgagtaatcaaccagcaaatataagtatcaaaccctagaaacattatttaaga |
11029628 |
T |
 |
| Q |
211 |
ctaaaa |
216 |
Q |
| |
|
|||||| |
|
|
| T |
11029627 |
ctaaaa |
11029622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 63
Target Start/End: Original strand, 1836844 - 1836896
Alignment:
| Q |
11 |
tgaaaagaagaaaaaacctgaggggcataacttataagttagaattacaaata |
63 |
Q |
| |
|
||||| |||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1836844 |
tgaaatgaagaaaaaaactgaggggcataagttataagttagaattacaaata |
1836896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University