View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_106 (Length: 227)
Name: NF3342_low_106
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_106 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 18012712 - 18012494
Alignment:
| Q |
5 |
catcatactcatccaggaagagtgtggggaattcttcatgtaataaagtatcatcattggcgtcatgtcaagagaaggattactcataggaggcattgta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18012712 |
catcatactcatccaggaagagtgtggggaattcttcatgtaataaagtatcatcattggcgtcatgtcaagagaaggattactcataggaggcattgta |
18012613 |
T |
 |
| Q |
105 |
gttatgatgcaggtaagcaagcatgtttggttaattcaaatcaattatcacttcattttagccattttatattaggaacaatattttaaatcatggtcgt |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18012612 |
gttatgatgcaggta----agcatgtttggttaattcaaatcaattatcacttcattttagcctttttatattaggaacaatgttttaaatcatggtcgt |
18012517 |
T |
 |
| Q |
205 |
catctatgtagtaccgacacttc |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
18012516 |
catctatgtagtaccgacacttc |
18012494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University