View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_111 (Length: 220)
Name: NF3342_low_111
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_111 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 32338851 - 32339041
Alignment:
| Q |
15 |
aatataaaagggattggggtgagacagttagccacgagttaaccatg-taaattaattcatttatccatggtcactataatatggctaaactacgccaca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32338851 |
aatataaaagggattggggtgagacagttagccacgggttaaccatggtaaattaattaatttatccatggtcactataatatggctaaactacgccaca |
32338950 |
T |
|
| Q |
114 |
ttgatttatagtatagagatcaaccagcatcaaacaaacatcatcaattttctgtttttattaagtattgatttaattgtcgagtagaaaa |
204 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32338951 |
ttgatttatagtatagagaccaaccagcatcaaacaaacatcatcaattttctgtttttattaagtattgatttaattgtcgagtagaaaa |
32339041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University