View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_114 (Length: 217)
Name: NF3342_low_114
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_114 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 40764808 - 40764990
Alignment:
| Q |
20 |
gaatggtacggaatttgagaatgaagtaacatggggaattgatttagcttctgagcatgaaaggtacttctacagttgttttttcaagttcttgttctta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764808 |
gaatggtacggaatttgagaatgaagtaaaatggggaattgatttagcttctgagcatgaaaggtacttctacagttgttttttcaagttcttgttctta |
40764907 |
T |
 |
| Q |
120 |
tcgtattgtgatttttctctattgataaatgttggttgttacttttgtgtgttgtattgtgttttttcttcaatgataaatgt |
202 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40764908 |
tcgtatcgtgttttttctctattgataaatgttggttgttacttttgtgtgttgtattgtgttttttcttcaatgataaatgt |
40764990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 20 - 168
Target Start/End: Original strand, 42912437 - 42912579
Alignment:
| Q |
20 |
gaatggtacggaatttgagaatgaagtaacatggggaattgatttagcttctgagcatgaaaggtacttctacagttgttttttcaagttcttgttctta |
119 |
Q |
| |
|
|||||||| | |||||||||| |||||| ||||||||| ||| ||||||| ||||||||||||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
42912437 |
gaatggtaagaaatttgagaaggaagtagaatggggaatcgatctagcttcagagcatgaaaggtacttctgtagttattttttcaa---cttgttctt- |
42912532 |
T |
 |
| Q |
120 |
tcgtattgtgatttttctctattgataaatgttggttgttacttttgtg |
168 |
Q |
| |
|
| || || ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
42912533 |
--gagttttgttttttctttaatgataaatgttggttgttacttttgtg |
42912579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University