View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_115 (Length: 215)
Name: NF3342_low_115
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_115 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 11960545 - 11960344
Alignment:
| Q |
15 |
cagtttgatagggatgtaaaaattggaaatttaaaattaaactaaaaagttaacaccaccaacttcatcctttaatcttctccaaaacatcattatgaat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11960545 |
cagtttgatagggatgtaaaaattggaaatttaaaattaaactaaaaagttaacaccaccaacttcatcctttaatcttctccaaaacatcatcatgaat |
11960446 |
T |
 |
| Q |
115 |
ttatgactatccctgaaactagcaagattttttccactgcta-ttcgccacacaccaccgctgccaaaccacaaacaactcttgggaaaacacatacaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11960445 |
ttatgactatccctgaaactagcaagattttttccactgccacttcgccacacaccaccgctgccaaaccacaaacaactcttgggaaaacacatacaaa |
11960346 |
T |
 |
| Q |
214 |
tc |
215 |
Q |
| |
|
|| |
|
|
| T |
11960345 |
tc |
11960344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University