View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_27 (Length: 375)
Name: NF3342_low_27
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 86 - 361
Target Start/End: Original strand, 527249 - 527536
Alignment:
| Q |
86 |
ttgctccatattttttgaacttggtttt-gtcatcagtttcttcaagcagtgtcctaatcctaatgatgctcagagaagagagctgagccttcggactgg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
527249 |
ttgctccatattttttgaacttggtttttgtcatcagcttcttcaagcagtgtcctaatcctaatgatgctcagagaagagagctgagccttcggactgg |
527348 |
T |
|
| Q |
185 |
gttagacccaacgcaaatcaagttttggtttcagaacaggcgcacttcactcaaggtaattttgaccaactaactacatgta-----------nnnnnnn |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
527349 |
gttagacccaacgcaaatcaagttttggtttcagaacaggcgcacttcactgaaggtaactttgaccaactaactacatgtattttttttttgttgttgt |
527448 |
T |
|
| Q |
274 |
ngcaggcatcacagttgccatgcatattgcggggtaaatttaattcttattagcatgaaatattataatccattaaataatttgtttg |
361 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||| |||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
527449 |
tgcaggcatcaccgttgccatgcatattgcggcgtaaatttaatttttattagcatcaaatactataatccattaaataatttgtttg |
527536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University