View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_36 (Length: 333)
Name: NF3342_low_36
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_36 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 7 - 333
Target Start/End: Complemental strand, 40183752 - 40183426
Alignment:
| Q |
7 |
ccatggtctgatacaatgtgcaactggtcccctgatggagattggattgcttttgcatcggatcgtcatgacccgggaagtggaagctttgaaatttatt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40183752 |
ccatggtctgatacaatgtgcaactggtcccctgatggagaatggattgcttttgcatcggatcgtcatgacccaggaagtggaagctttgaaatttatt |
40183653 |
T |
 |
| Q |
107 |
tgatccacccggatggaaccgggttgaggaaactgattcacagtggttcaggtgggaggacgaatcatccttattttagccctgatggaaagagtatggt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40183652 |
tgatccacccggatggaaccgggttgaggaaactgattcacagtggttcaggtgggaggacgaatcatccttattttagccctgatggaaagagtatggt |
40183553 |
T |
 |
| Q |
207 |
gtttacatcagattatgcaggaatatcagcggatccaatctctaaccctcatcattatcaaccttacggtgaaatattcaccgtgaggatggattgttcg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
40183552 |
gtttacatcagattatgcaggaatatcagcggagccaatctctaaccctcatcattatcaaccttacggtgaaatatttaccgtgaggttggatggttcg |
40183453 |
T |
 |
| Q |
307 |
gtttgatcaagattgactcatacttct |
333 |
Q |
| |
|
| || | ||||||||||||||| |||| |
|
|
| T |
40183452 |
ggtttaacaagattgactcataattct |
40183426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University