View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_4 (Length: 591)
Name: NF3342_low_4
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 1e-95
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 2748659 - 2748474
Alignment:
| Q |
20 |
ggaggaaggtttgttgcatctcaatctccatctagcccatttaaaaaacaacacagtttcaagaaagactgataaatcagtaaaactttttaagtaaacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748659 |
ggaggaaggtttgttgcatctcaatctccatccagcccatttaaaaaacaacacagtttcaagaaagactgataaatcagtaaaactttttaagtaaacc |
2748560 |
T |
 |
| Q |
120 |
tcttctaccgctgccctcaagatagcttgatcacaacttttgaaatatttagagaacattgaaaaaggatgaagatctttaggctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748559 |
tcttctaccgctgccctcaagatagcttgatcgcaacttttgaaatatttagagaacattgaaaaaggatgaagatctttaggctt |
2748474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 262 - 378
Target Start/End: Complemental strand, 38092992 - 38092879
Alignment:
| Q |
262 |
tggtaacgattgccacatatatacatgatcaattacgcactttatataagtggtttcgatgtttttggcaatggataaccggttgcactgaggggtgtaa |
361 |
Q |
| |
|
|||||||| ||||||||| |||| ||| ||||||| ||||||| | ||| |||||| |||||||||||||| | |||||| |||||| ||||| ||| | |
|
|
| T |
38092992 |
tggtaacg-ttgccacat-tatatgtgaccaattacacactttacagaagaggtttcaatgtttttggcaattg-taaccgtttgcaccgagggatgtta |
38092896 |
T |
 |
| Q |
362 |
ccggttaccatgtaaaa |
378 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
38092895 |
ccggtcaccatgtaaaa |
38092879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 313 - 372
Target Start/End: Original strand, 14772639 - 14772698
Alignment:
| Q |
313 |
ggtttcgatgtttttggcaatggataaccggttgcactgaggggtgtaaccggttaccat |
372 |
Q |
| |
|
||||| || ||||||||||||| |||| ||||||||||| ||||||||| ||||||||| |
|
|
| T |
14772639 |
ggttttgaggtttttggcaatgtgtaacaggttgcactgaagggtgtaactggttaccat |
14772698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University