View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_46 (Length: 310)
Name: NF3342_low_46
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 40 - 181
Target Start/End: Complemental strand, 923833 - 923692
Alignment:
| Q |
40 |
tttaattatttacatatttttctagggtttacaccggctaattatttgtgtgagatgcgacctaatttttaccaactgaatcaaccttttcgttaattat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
923833 |
tttaattatttacatatttttctagggtttacaccggctaattatttgtgtgagatgcgacctaatttttaccaactgaatcaaccttttcgttaattat |
923734 |
T |
 |
| Q |
140 |
catgttcattttttgccatcaaatttagcttctctctttatc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
923733 |
catgttcattttttgccatcaaatttagcttctctctttatc |
923692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 65 - 178
Target Start/End: Complemental strand, 915759 - 915646
Alignment:
| Q |
65 |
ggtttacaccggctaattatttgtgtgagatgcgacctaatttttaccaactgaatcaaccttttcgttaattatcatgttcattttttgccatcaaatt |
164 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
915759 |
ggtttacaccggctgattatttgtgtgagatgcgacctaatttttatcaactgaatcaactttttcgttaattatcatgttcattttttcccatcaaatt |
915660 |
T |
 |
| Q |
165 |
tagcttctctcttt |
178 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
915659 |
tggcttctctcttt |
915646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 88 - 170
Target Start/End: Complemental strand, 909208 - 909126
Alignment:
| Q |
88 |
tgtgagatgcgacctaatttttaccaactgaatcaaccttttcgttaattatcatgttcattttttgccatcaaatttagctt |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||| | || |||||| |||| ||||||||| |
|
|
| T |
909208 |
tgtgagatgcgacctaatttttaccaactgaatcaacttttacgttaattatcacatgcagattttgctatcacatttagctt |
909126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 299
Target Start/End: Complemental strand, 915543 - 915515
Alignment:
| Q |
271 |
gtatctactaacttgggtgaaggatatct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
915543 |
gtatctactaacttgggtgaaggatatct |
915515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 271 - 299
Target Start/End: Complemental strand, 923602 - 923574
Alignment:
| Q |
271 |
gtatctactaacttgggtgaaggatatct |
299 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
923602 |
gtatctactaacttgggtgaaggatatct |
923574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University