View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_54 (Length: 284)
Name: NF3342_low_54
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 43702931 - 43702658
Alignment:
| Q |
1 |
ttgaacaccaacagcttcatcgctcacatctacttattacaataaccaataatcagttacaccgaaatttcaatttcataaactaatatcgaagaaacgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
43702931 |
ttgaacaccaacagcttcatcgctcacatctacttattacaataaccaataatcagttacaccgtaatttcaatttcataaactaatattgaagaaacgc |
43702832 |
T |
|
| Q |
101 |
aacattcnnnnnnnnnnnnnnnnncctgttatggatgcggactttgaaccgggtttagcgtggatggttatagcgacggatgaaggaggcatgcagcgaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702831 |
aacattcagagagagaaagagagacctgttatggatgcggactttgaaccgggtttagcgtggatggttatagcgacggatgaaggaggcatgcagcgaa |
43702732 |
T |
|
| Q |
201 |
tacaagacggaatattgttaggtttttccgaaggaaccgtttcctttggttctgcctttgcttttcccttcttc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702731 |
tacaagacggaatattgttaggtttttccgaaggaaccgtttcctttggttctgcctttgcttttcccttcttc |
43702658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University