View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3342_low_59 (Length: 274)

Name: NF3342_low_59
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3342_low_59
NF3342_low_59
[»] chr4 (1 HSPs)
chr4 (188-258)||(24349286-24349356)


Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 188 - 258
Target Start/End: Complemental strand, 24349356 - 24349286
Alignment:
188 ttcgggttattttctcaacaaggatgctataggatcaatatgtgcattcgggacgagaataatgaatttat 258  Q
    |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24349356 ttcgagttatttcctcaacaaggatgctataggatcaatatgtgcattcgggacgagaataatgaatttat 24349286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University