View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_63 (Length: 268)
Name: NF3342_low_63
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 42 - 260
Target Start/End: Original strand, 525899 - 526117
Alignment:
| Q |
42 |
tcacctcttctcaggcttcaccatcaccacctcctaagtaataatcttctatcatattcaaactcattttgcatgtgttttttcattctcttttaggaca |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
525899 |
tcacctcttctcaggcttcaccatcaccacctcctaactaataatcttatatcatattcaaactcatttttcatgtgttttttcattctcttttaggaca |
525998 |
T |
|
| Q |
142 |
acctcttaaaccatagcagttccataattcccttcccacacccccacccacttgttttttagtttcttatactacatgacccacttacatatatgttcca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
525999 |
acctcttaaaccatagcagttccataattcccttcccacacccccacccacttgttttttagtttcttatactacatgacccacttacatatatgttcca |
526098 |
T |
|
| Q |
242 |
atcgcaacgtctctctgct |
260 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
526099 |
atcgcaacgtctctctgct |
526117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 527862 - 527814
Alignment:
| Q |
1 |
catctcgaagtttttcattctcaatctttaatagctcattctcacctct |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
527862 |
catctcgaagtttttcattctcaatctttaatagctcattctcatctct |
527814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University