View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3342_low_64 (Length: 265)

Name: NF3342_low_64
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3342_low_64
NF3342_low_64
[»] chr4 (1 HSPs)
chr4 (75-145)||(25729359-25729429)


Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 25729429 - 25729359
Alignment:
75 agtgtgggttgctctatgataccattatatattagcttgcaattgacaacgaagaaatgaactttaacgtc 145  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||    
25729429 agtgtgggttgctctatgatactattatatattagcttgcaattgacaacgaagaaatgagctttaacgtc 25729359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University