View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_65 (Length: 264)
Name: NF3342_low_65
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 15888197 - 15887950
Alignment:
| Q |
1 |
tacaatctaaaggtcagtgacattgtaaaatgacattatctatctaattatgcagtattctcctttagtttttcataggtttcctccacttgagataatc |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15888197 |
tacaatctaaatgtcagtgacattgtaaaatgacattatctatctaattatgcagtattctcctttagtttttcataggtttcctccacttgagataatc |
15888098 |
T |
 |
| Q |
101 |
gagtaaatggttttttcataacctaagaacatcaaccgttcctgatttcaaaattacttcattcatatgaatccagatggactaaattatggccaacact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15888097 |
gagtaaatggttttttcataacctaagaacatcaaccgttcctgatttcaaaattacttcattcatatgaatccagatggactaaattatgaccaacact |
15887998 |
T |
 |
| Q |
201 |
atccagatcgacaatgttaccaccgaaatctagcacaagcgactggtg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15887997 |
atccagatcgacaatgttaccaccgaaatctagcacaagcggctggtg |
15887950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University