View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_78 (Length: 250)
Name: NF3342_low_78
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_78 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 31797622 - 31797841
Alignment:
| Q |
18 |
tttcataagctcaattttacatattggatgatatagtgaatacttatggtcatgaaaaatggcactgctcgttgtacaccaactactagcatcattatac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31797622 |
tttcataagctcaattttacatattggatgatttagtgaatacttatggtcatgaaaaatggcactgctcgttgtacaccaactactagcatcattatac |
31797721 |
T |
|
| Q |
118 |
aaagtttgtgtgcaacaagtataatctgtttcaactccaaagttcttatgagaaaacatatcttcgtgcatataattgaaatttctgatcttatttattc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31797722 |
aaagtttgtgtgcaacaagtataatctgtttcaactccaaagttcttatgagaaaacatatcttcgtgcatataattgaaatttctgatcttatttattc |
31797821 |
T |
|
| Q |
218 |
tagtggcattacttgtctct |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31797822 |
tagtggcattacttgtctct |
31797841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 139 - 209
Target Start/End: Original strand, 31787308 - 31787378
Alignment:
| Q |
139 |
taatctgtttcaactccaaagttcttatgagaaaacatatcttcgtgcatataattgaaatttctgatctt |
209 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||| || |||||| |
|
|
| T |
31787308 |
taatctctttcaactccaaagttcttgtgagaaatcatatcttcgtgcatataattgaaatgtccgatctt |
31787378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 67
Target Start/End: Original strand, 31787163 - 31787210
Alignment:
| Q |
20 |
tcataagctcaattttacatattggatgatatagtgaatacttatggt |
67 |
Q |
| |
|
||||||| | |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
31787163 |
tcataagataaattttacctatttgatgatatagtgaatacttatggt |
31787210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University