View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3342_low_82 (Length: 247)

Name: NF3342_low_82
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3342_low_82
NF3342_low_82
[»] chr3 (2 HSPs)
chr3 (82-234)||(31553170-31553322)
chr3 (21-73)||(31553343-31553395)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 82 - 234
Target Start/End: Complemental strand, 31553322 - 31553170
Alignment:
82 gtatagagaactcatattcctaaacatttttagcaattaagggaatacaaaaatatatagtagcagtatcattaaagaaggaaacaaaagaagccccttc 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||||||    
31553322 gtatagagaactcatattcctaaacatttttagcaattaagggaatacaaaaaaatataggagcagtattattaaagaaggaaacaaaagaagccccttc 31553223  T
182 ttttttaaacatgtcttttcatatattcatacatatgcatgccatacacctct 234  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
31553222 ttttttaaacatgtcttttcatatattcatacatatgcatgccatacacctct 31553170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 73
Target Start/End: Complemental strand, 31553395 - 31553343
Alignment:
21 tatcatatcactctctttatctatggcttttaggtatagagatctcattccct 73  Q
    |||||||||||| ||||||||||||| ||||||||||||||| ||||||||||    
31553395 tatcatatcactgtctttatctatgggttttaggtatagagaactcattccct 31553343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University