View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_82 (Length: 247)
Name: NF3342_low_82
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 82 - 234
Target Start/End: Complemental strand, 31553322 - 31553170
Alignment:
| Q |
82 |
gtatagagaactcatattcctaaacatttttagcaattaagggaatacaaaaatatatagtagcagtatcattaaagaaggaaacaaaagaagccccttc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31553322 |
gtatagagaactcatattcctaaacatttttagcaattaagggaatacaaaaaaatataggagcagtattattaaagaaggaaacaaaagaagccccttc |
31553223 |
T |
 |
| Q |
182 |
ttttttaaacatgtcttttcatatattcatacatatgcatgccatacacctct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31553222 |
ttttttaaacatgtcttttcatatattcatacatatgcatgccatacacctct |
31553170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 73
Target Start/End: Complemental strand, 31553395 - 31553343
Alignment:
| Q |
21 |
tatcatatcactctctttatctatggcttttaggtatagagatctcattccct |
73 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
31553395 |
tatcatatcactgtctttatctatgggttttaggtatagagaactcattccct |
31553343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University