View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_85 (Length: 244)
Name: NF3342_low_85
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_85 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 44495060 - 44495160
Alignment:
| Q |
1 |
tcagctacataagaactacgtcttccccaatattaggagaaacaacatgtattctcattgatctcctctaattagg-ccaccacaacctgacctcacacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44495060 |
tcagctacataagaactacgtcttcccaaatatttggagaaacaacatgcattctcattgatctcctctaattaggcccaccacaacctgacctcacacc |
44495159 |
T |
|
| Q |
100 |
c |
100 |
Q |
| |
|
| |
|
|
| T |
44495160 |
c |
44495160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University