View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_91 (Length: 241)
Name: NF3342_low_91
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_91 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 3938689 - 3938893
Alignment:
| Q |
1 |
caacaagcatcctctccaagaaatggaaccaactatggctctcacttctcaatcttgattttgacgaccaaggctctccaaacttcttagcttttcgaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3938689 |
caacaagcatcctctccaagaaatggaaccaactatggctctcagttctcactcttgattttgacgaccaaggctctccaaacttcttagcttttcgaca |
3938788 |
T |
|
| Q |
101 |
ttttgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattccgtctcaaatgtggcttcattcaaatatgtgatccatatgatatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
3938789 |
ttttgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattcc------------------ttcaaagatgtgatccatatgatatc |
3938870 |
T |
|
| Q |
201 |
aatcgattcatttctgttgctgt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3938871 |
aatcgattcatttctgttgctgt |
3938893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 91 - 169
Target Start/End: Original strand, 12651704 - 12651782
Alignment:
| Q |
91 |
cttttcgacattttgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattccgtctcaaatgtgg |
169 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| ||||||| | ||| ||| |||| ||| ||||| ||||||||||| |
|
|
| T |
12651704 |
cttttcgactttttgtctactcagtcatgctcacgcgtgacccaacctcgccaatccaatcgttccgactcaaatgtgg |
12651782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 71
Target Start/End: Complemental strand, 47606642 - 47606574
Alignment:
| Q |
3 |
acaagcatcctctccaagaaatggaaccaactatggctctcacttctcaatcttgattttgacgaccaa |
71 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||||||| |||| ||| || | || ||||||||| |
|
|
| T |
47606642 |
acaagcatcctctcaaagagatggaacccactatggctctcagttcttaattttcacttcgacgaccaa |
47606574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 90 - 169
Target Start/End: Original strand, 12504948 - 12505027
Alignment:
| Q |
90 |
gcttttcgacattttgtctacttagtcatgctcatgcgtgacgcttccttgcccatccgatcattccgtctcaaatgtgg |
169 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||||||| |||||| | | ||||||||||||| |||| ||||||||||| |
|
|
| T |
12504948 |
gcttttcgacttttcgtctactcagtcatgctcatccgtgaccccacattgcccatccgattgttccacctcaaatgtgg |
12505027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University