View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_94 (Length: 240)
Name: NF3342_low_94
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_94 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 18066818 - 18066589
Alignment:
| Q |
1 |
tgtcccttgttttgctttccaacattcgggtccaggcacaaggtatgagcattttacttcttttctttttagataatcatcttcttcaagaaatgaagtt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
18066818 |
tgtcacttgttttgctttccaacattcgggtccaggcacaaggtatgagcattttacttcttttatttttagataatcatcttcttcaataaatgaagtt |
18066719 |
T |
|
| Q |
101 |
ctcacnnnnnnnnaatcaagtaaacatggtttcctgt------tttataccgtttttaatcaagtnnnnnnntgatagttaattttgtaagaggaaacaa |
194 |
Q |
| |
|
||||| |||||||||||||||||||||| | |||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
18066718 |
ctcac-tttttttaatcaagtaaacatggtttcctattttatatttataccgtttttaatcaagtaaaaaatt-atagttaattttgtaagaggaaacaa |
18066621 |
T |
|
| Q |
195 |
taatgttttatgaatatagtcaaatgatttct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18066620 |
taatgttttatgaatatagtcaaatgatttct |
18066589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 18130093 - 18129867
Alignment:
| Q |
1 |
tgtcccttgttttgctttccaacattcgggtccaggcacaaggtatgagcattttacttcttttctttttagataatcatcttcttcaagaaatgaagtt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
18130093 |
tgtcacttgttttgctttccaacattcgggtccaggcacaaggtatgagcattttacttcttttatttttagataatcatcttcttcaataaatgaagtt |
18129994 |
T |
|
| Q |
101 |
ctcacnnnnnnnnaatcaagtaaacatggtttcctgt------tttataccgtttttaatcaagtnnnnnnntgatagttaattttgtaagaggaaacaa |
194 |
Q |
| |
|
||||| |||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18129993 |
ctcac-tttttttaatcaagtaaacatggtttcctattttatatttataccgtttttaatcaagt-aaaaaatgatagttaattttgtaagaggaaac-- |
18129898 |
T |
|
| Q |
195 |
taatgttttatgaatatagtcaaatgatttct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18129897 |
-aatgttttatgaatatagtcaaatgatttct |
18129867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 18105091 - 18104987
Alignment:
| Q |
1 |
tgtcccttgttttgctttccaacattcgggtccaggcacaaggtatgagcattttacttcttttctttttagataatcatcttcttcaagaaatgaagtt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18105091 |
tgtcacttgttttgctttccaacattcgggtccaggcacaaggtatgagcattttacttcttttatttttagataatcatcttcttcaagaaatgaagtt |
18104992 |
T |
|
| Q |
101 |
ctcac |
105 |
Q |
| |
|
||||| |
|
|
| T |
18104991 |
ctcac |
18104987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 56 - 105
Target Start/End: Complemental strand, 18111179 - 18111130
Alignment:
| Q |
56 |
acttcttttctttttagataatcatcttcttcaagaaatgaagttctcac |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18111179 |
acttcttttatttttagataatcatcttcttcaataaatgaagttctcac |
18111130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University