View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3342_low_95 (Length: 239)
Name: NF3342_low_95
Description: NF3342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3342_low_95 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 29751659 - 29751438
Alignment:
| Q |
1 |
ttttatgggaatcgatgattccaacaatgcttctgctgtttcaatggagaatttggtcaatggttgtaaccctgacctaaatctcaaccctcctaatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29751659 |
ttttatgggaatcgatgattccaacaatgcttctgctgtttcaatggagaatttggtcaatggttgtaaccctgacctaaatctcaaccctcctaatttg |
29751560 |
T |
|
| Q |
101 |
ggggtggattctattgattctgagccctgtgagggaaatgatcgagcgattgttgttgttccggagaaacaagagacggcggttgcggtggttaggaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29751559 |
agggtggattctattgattctgagccctgtgagggaaatgatcgagcgattgttgttgttccggagaaacaagagacggcggttgcggtggttaggaaga |
29751460 |
T |
|
| Q |
201 |
aagcaagtcaagtgatggagct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29751459 |
aagcaagtcaagtgatggagct |
29751438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 111
Target Start/End: Original strand, 30125883 - 30125974
Alignment:
| Q |
17 |
gattccaacaatgcttctgctgtttcaatggagaatttggtcaatggttgtaaccctgacctaaatctcaaccctcctaatttgggggtggattc |
111 |
Q |
| |
|
||||||||||||| || || ||||||| |||||||| ||| |||| |||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
30125883 |
gattccaacaatgattttgttgtttcattggagaatacggtaaatgtttgtaaccagaacctaaatctcaac---cttaatttgggggtggattc |
30125974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 51
Target Start/End: Complemental strand, 29755202 - 29755161
Alignment:
| Q |
10 |
aatcgatgattccaacaatgcttctgctgtttcaatggagaa |
51 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
29755202 |
aatcgatgattccagcaatgcttctgccgcttcaatggagaa |
29755161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University